Factors affecting the clinical outcome of bluetongue virus infection in adult mice Saminathan M.1,6, Singh K.P.6,*, Vineetha S.1,6, Maity Madhulina1,6, Biswas S.K.2,6, Reddy G.B. Manjunatha3,6, Milton A.A.P.4,6, Chauhan H.C.5,6, Chandel B.S.5,6, Ramakrishnan M.A.2,6, Gupta V.K.6 6Centre for Animal Disease Research and Diagnosis, ICAR-Indian Veterinary Research Institute, Izatnagar, Bareilly-243122, Uttar Pradesh; 1Division of Pathology, ICAR-IVRI, Izatnagar, Bareilly-243122, Uttar Pradesh; 2Division of Virology, ICAR-IVRI, Mukteswar Campus, Nainital-263138, Uttarakhand; 3ICAR-National Institute of Veterinary Epidemiology and Disease Informatics, Bengaluru, Karnataka; 4Division of Animal Health, ICAR-RC-NEH Region, Umiam, Barapani-793103, Meghalaya; 5Department of Veterinary Microbiology, College of Veterinary Science and Animal Husbandry, Sardarkrushinagar, Dantiwada Agricultural University, Sardarkrushinagar-385506, Gujarat, India *Corresponding author: e-mail: karam.singh@rediffmail.com
Abstract The clinical outcome of bluetongue virus (BTV) infection is determined by several factors, such as species, age, breed, immunological status, serotype/strain of BTV, and environmental factors. In the present study, influence of various virus and host factors-like route of infection [subcutaneous (S/C) and intravenous route (I/V)], quantity of virus (50, 75, and 100 pl volume of BTV-1), and type I IFNs (IFN-α and IFN-β levels in I/V route of inoculation) in the clinical outcome of BTV infection were studied in adult Swiss albino mice (female, 6–8 weeks old) in three separate experiments. The dose of BTV-1 in all three experiments was 1x106 TCID50/ml. Development of clinical signs or disease or mortality was not observed up to 120 hpi in all three experiments inoculated either S/C or I/V routes. In S/C route, BTV nucleic acid was detected from the lymph node on 12 to 36 hpi, blood from 24 to 48 hpi, and in spleen from 36 to 60 hpi by RT-PCR using VP7 gene segment of BTV. In I/V route, BTV was detected from blood 6 to 36 hpi, lymph node on 24 to 48 hpi and in spleen from 36 to 60 hpi. The IFN-α level was started to increase at 12 hpi, reached peak levels at 36 and 48 hpi in serum and spleen, respectively and there after the levels were decreased rapidly in serum and spleen tissue homogenate as detected by c-ELISA and qRT-PCR. The IFN-β level was increased at 6 hpi, reached peak at 24 and 36 hpi in serum and spleen, respectively and the levels were decreased rapidly in I/V route of inoculation. No recognizable gross and histopathological lesions were noticed in various organs of subcutaneously or intravenously inoculated groups. Only few macrophages and lymphocytes showed positive immunolabelling of BTV-1 antigen in lymph nodes from 24 to 48 hpi and in spleen from 36 to 60 hpi in I/V route of inoculation. Top Keywords Adult mice, Quantity of virus, BTV-1, Clinical outcome, Route of infection, Type-I IFNs. Top |
INTRODUCTION Bluetongue (BT) is a non-contagious, infectious, arthropod borne viral disease of domestic and wild ruminants caused by BTV belonging to genus Orbivirus and family Reoviridae. An interesting aspect of BT is extreme variability of the clinical outcome. In many cases, BTV induced only mild or inapparent clinical manifestation1, while in others it is fatal to the infected host2. The clinical outcome of BTV infection is determined by several factors, such as species, age, breed, immunological status of the infected host, serotype/topotype/strain of BTV, and environmental factors such as exposure to solar irradiation1,3,4. |
BTV is a potent inducer of type I interferons (IFNs) namely, IFN-α and IFN-β in many in vivo and in vitro models from different tissues and host species5,6,7,8,9-10. Type I IFNs plays an essential role in the antiviral innate immune response. Although, BTV replicates substantial fraction in the conventional dendritic cells (cDCs) and plasmacytoid dendritic cells (pDCs), only pDCs produces significant amount of IFN-α/β. A temporal relationship between viremia and IFN-α activity has been observed in sheep infected with BTV, where IFN peak concentrations decreased approximately 90% of virus titre9,11. BTV is a potent type I interferon inducer in wild type mice without virus replication6 but in IFNAR(−/-) mice there is a strong correlation between BTV replication, viremia, clinical disease, and the induction of IFN-α and IFN-β. Blocking of IFN-α/β activity in mice resulted in the disruption of IFN-α/β-induced signaling, which is an important determinant of the tissue tropism and pathogenicity of BTV in mice and unable to establish an antiviral state leads to a dramatically increased sensitivity to BTV12,13. |
Mice have been used as the model for studying the pathogenesis of BTV-induced cerebral malformations14,15. For many years, different groups have tried to establish a adult laboratory animal model to facilitate the studies of pathogenesis, immune response, and testing of vaccines against BTV. Natural hosts-like sheep and cattle are expensive and require specialized animal facilities. BTV grows faster in 1-day-old suckling mice inoculated intracerebrally than at 2-week-old14. In contrast, adult mice are not susceptible to BTV infection and viremia is not observed in mice inoculated either intravenously or subcutaneously12. Previous studies showed that lesions caused by BTV infection of the central nervous system in sheep and mice vary with age of the host suggesting that appearance of the lesions were influenced by the age (immunological maturity) of the host15. In the present study, influence of various viruses and host factors-like route of infection, quantity of virus, and type I IFNs in the clinical outcome of BTV infection in adult mice was experimentally studied. |
Top MATERIALS AND METHODS Bluetongue virus serotype-1 The BTV-1 used in the present study was isolated from abortions and stillbirths in goats from Sardarkrushinagar, Gujarat in July 200716. The BTV-1 (SKN-10) was obtained from Virus Repository of All India Network Program on Bluetongue (AINP-BT), ICAR-IVRI, Mukteshwar Campus, Uttarakhand, India. The virus was isolated by culturing on baby hamster kidney-21 (BHK-21) cells. Serotype specific PCR was performed using BTV-1 segment 2 (VP2) primers to confirm the virus serotype. The virus was titrated in BHK-21 cells to determine the tissue culture infective dose (TCID50) by endpoint titration assay. The details of the primers are given in Table 1. Experimental animals The required number of female virgin (6–8 weeks old), Swiss albino mice were procured from Laboratory Animal Resource (LAR) Section, ICAR-IVRI, Izatnagar. The animals were kept in polypropylene cages at RT (24 ± 10°C) and relative humidity of 60 ± 10% with 12/12 h light/dark cycle, and provided feed and water ad libitum. The mice were maintained in insect proof accommodation of Experimental Animal Facility of Centre for Animal Disease Research and Diagnosis, IVRI, Izatnagar. All the experiments were performed in accordance with guidelines of the Institute Animal Ethics Committee (IAEC). Three separate experiments were conducted to assess the virus and host factors influencing the clinical outcome of BTV infection in adult mice. Experiment-1: Role of route of infection in establishment of BTV-1 infection in adult mice Adult female Swiss albino mice were divided into 2 groups. Group-I mice were inoculated subcutaneously and group-II mice intravenously with 50 μl of 1×106 TCID50/ml of BTV-1. In both groups, mice were monitored for 120 hours post infection (hpi) for development of any clinical signs or mortality. At the end of an exposure period of each interval, 3 mice each from infected groups were euthanized by humane cervical dislocation on 6, 12, 24, 36, 48, 60, 72, 84, 96, and 120 hpi. During euthanasia, blood was collected from both infected and control mice heart with EDTA coated vacutainers for detection of BTV-1 and type I IFN cytokines gene expression studies by quantitative real-time PCR (qRT-PCR). Blood also collected in without EDTA vacutainers for serum type I IFN cytokines estimation. The tissues from axillary and inguinal lymph nodes, lungs, spleen, heart, thymus, brain, etc. were collected in 10% neutral buffered formalin (NBF) for histopathology and in RNAlater® (Ambion, USA) for BTV-1 detection and cytokine gene quantification, and stored at −80°C. Experiment-2: Role of quantity of virus in establishment of BTV-1 infection in adult mice The female mice were inoculated I/V into the lateral tail vein with 50, 75 and 100 μl volume containing 1×106 TCID50/ml of BTV-1 serotype. The control mice were inoculated I/V with 50 μl volume of tissue culture medium without virus. In both groups, mice were monitored for 120 hpi for any clinical signs or mortality. At the end of an exposure period of each interval, mice were euthanized and samples were collected as that of Experiment-I. Experiment-3: Role of type I IFNs in establishment of BTV-1 infection in adult mice The adult female mice (6–8 weeks of age) were inoculated I/Vwith 50 μl of 1×106 TCID50/ml of BTV-1 using tuberculin syringe (26 gauge needle) and acted as infected group. The control mice were inoculated I/V with 50 μl volume of tissue culture medium without virus and acted as mock-infected control group. In both groups, mice were monitored for 120 hpi for any clinical signs or mortality. At the end of an exposure period of each interval, mice were euthanized and samples were collected similar to that of Experiment-I. Clinical observations All mice were observed and recorded daily for mortality and clinical signs-like dullness, anorexia, ocular and nasal discharges, respiratory signs, behaviour and nervous signs. Postmortem lesions Systematic postmortem examination was carried out and gross findings were recorded. The axillary and inguinal lymph nodes, lungs, spleen, heart, thymus, brain, etc. examined for gross lesions and collected for histopathological studies. Histopathology After proper fixation, tissues were processed for routine paraffin wax embedding, sections of 4–5 μ thickness were cut and stained with haematoxylin and eosin (H&E) as per standard procedure. Duplicate sections were taken on the APES (3-Aminopropyl triethoxysilane) coated glass slides to carry out IHC. Immunohistochemistry for demonstration of BTV-1 antigen BTV-1 antigen localisation was demonstrated in formalin fixed tissues of lymph nodes and spleen of infected mice by indirect immunoperoxidase technique using anti-BTV antibodies. Briefly, the protocol was as follows: The tissue sections were de-paraffinised with xylene and rehydrated through graded alcohols followed by gently rinsing in distilled water (DW). Heat induced antigen retrieval was performed by immersing the tissue sections in 10 mM sodium citrate buffer (pH 6.0) and heated for 15 min (3 cycles of 5 min each) in microwave oven. Then the slides were washed with PBS and incubated in freshly prepared 3% H2O2 in 80% methanol for 30 min in dark chamber to quench the endogenous peroxidase. The sections were covered with 5% normal goat serum (Invitrogen; Product No. 016201) in PBS (pH 7.4) for blocking of non-specific antigen in humidified chamber for 1 hour at RT. The tissue sections were covered with hyper-immune serum against BTV-1 core antigen raised in rabbit, and incubated overnight in humidified chamber at 4°C. Then, the slides were incubated with peroxidase-conjugated goat anti-rabbit secondary antibodies (Sigma-Aldrich, St. Louis, Missouri, USA) for 1 hour at 37°C. To demonstrate the immunolabeling, the slides were incubated with ImmPACT™ DAB peroxidase substrate (Vector Laboratories, Inc., Burlingame, CA, USA) for 30–60 seconds and washed with DW. The slides were counter stained with Mayer‘s haematoxylin for 2 min and rinsed in tap water. The sections were covered with CC/MountTM (Sigma-Aldrich, St. Louis, Missouri, USA) and slides were dried at RT for 45 min to 1 hour. The sections were examined under the microscope for positive signals. Cytokine estimation by competitive enzyme linked immunosorbent assay (c-ELISA) Type I IFNs such as IFN-α and IFN-β were estimated from serum and spleen tissue homogenate using mouse interferon-a (Cat. No: E03I0343), and mouse interferon-P (Cat.No: E03I0344) c-ELISA kits (Blue Gene Biotech, Shanghai, China). Preparation of spleen tissue homogenate Spleen tissues were rinsed thoroughly in chilled PBS (pH 7.0–7.2) to remove excess blood and minced into small pieces and homogenized with 500 μl of PBS. The suspension was sonicated and freeze thawed frequently to break the cell membranes. Then, the homogenate was centrifuged at 5000 rpm for 15 min. The supernatant was collected and stored at −80°C. The manufacture‘s protocol was followed for estimation of cytokines by c-ELISA from serum and spleen tissue homogenates. The standard curve was used to determine the concentration in unknown samples. The sensitivity of this kit was 1.0 μg/mL. RNA extraction and reverse transcription Total RNA was isolated from blood and tissues using TRIzol− reagent (Invitrogen−, ThermoFisher Scientific, Carlsbad, CA, USA) as per manufacture‘s recommendations. Equal concentration of total RNA was taken for complementary DNA (cDNA) synthesis using RevertAid First Strand cDNA synthesis kit (Thermo Scientific, Carlsbad, CA, USA) following the manufacturer‘s protocol. Detection of BTV nucleic acid by RT-PCR Detection of BTV nucleic acid from different organs and blood at specified time intervals by RT-PCR was done using 2× DreamTaq green PCR master mix (Thermo Scientific, Carlsbad, CA, USA) as per the manufacturer‘s instruction. The amplified PCR products were visualized in 1.5% agarose gel prepared in 1x tris-borate-EDTA (TBE) buffer containing ethidium bromide. Quantitative Real-time PCR for cytokine gene expression The mRNA gene expression levels of type I IFN cytokines (IFN-α and IFN-β) were quantified in blood and spleen of infected and control groups at specified time intervals by qRT-PCR using GAPDH as internal reference gene and QuantiFast® SYBR® Green PCR Kit (Cat No. 204054; Qiagen, USA) in CFX96− Real-Time System (BIO-RAD, USA). The details of gene specific primers used in this present study are given in Table 2. Statistical analysis The data were analyzed using GraphPad Prism, Version 5.0 (GraphPad Software Inc. San Diego, CA, USA). The mean of the infected and control groups at specified time intervals were calculated and expressed as mean ± standard error of the mean. The two-way ANOVA followed by Bonferroni post-test was used. For all comparisons, differences were considered significant at P<0.05. For real time analysis, the data obtained were analysed by using 2−AAa method. Top RESULTS Experiment-1: Influence of route of infection The experiment was designed to assess the route of infection as a potential factor on the clinical outcome of BTV infection in adult mice. No development of clinical signs or disease or mortality was observed up to 120 hpi in either S/C or I/V inoculated groups. In S/C route of inoculation, BTV nucleic acid was detected from the lymph node adjacent to the site inoculation on 12 to 36 hpi, blood from 24 to 48 hpi and in spleen from 36 to 60 hpi by RT-PCR using VP7 gene segment of BTV. In I/V route of inoculation, the BTV nucleic acid was detected from the blood 6 to 36 hpi, lymph node on 24 to 48 hpi and in spleen from 36 to 60 hpi. Slightly increased levels of type I IFNs in serum and spleen tissue homogenate was observed in S/C route of inoculation when compared to I/V route by c-ELISA. No recognizable gross lesions were noticed in various organs. Further, no histopathological differences were observed in lymph nodes, lungs, spleen, heart, thymus, brain, liver, and kidneys of S/C or I/V inoculated groups. Experiment-2: Role of quantity of virus in establishment of infection The experiment was designed to assess the dose of virus as potential factor on the clinical outcome of BTV infection in adult mice. No development of clinical signs or disease or mortality was observed in different doses of BTV (50, 75 and 100 μl of 1×106 TCID50/ml) inoculated mice up to 120 hpi. Further, BTV-1 was detected from blood in 6 to 36 hpi, lymph node on 24 to 60 hpi, and in spleen from 24 to 72 hpi in 75 and 100 μl of BTV-1 by RT- PCR (Fig. 1). The type I IFNs levels in serum and spleen tissue homogenates were significantly increased in 75 and 100 μl of BTV-1inoculated group when compared to 50 μl of BTV-1. No recognizable gross lesions were noticed in various organs. Further, no histopathological differences were observed in spleen, heart, thymus, brain, liver, and kidneys of BTV-1 inoculated mice at different doses (Fig. 6). However, lymph node showed mild lymphoid depletion in cortex (Fig. 6b) and lungs showed congestion in interalveolar capillaries and mild thickening of interalveolar septa (Fig. 6f) at 120 hpi of 100 μl of BTV-1 inoculated group. Experiment-3: Role of type I IFNs in establishment of infection The study was designed to assess the type I IFNs as a potential factor on the clinical outcome of BTV infection in adult mice. No development of clinical signs or disease or mortality was observed up to 120 hpi. The BTV nucleic acid was detected from the blood 6 to 36 hpi, lymph node on 24 to 48 hpi and in spleen from 36 to 60 hpi by RT-PCR. Type I IFNs such as IFN-α and IFN-β levels were estimated in serum and spleen tissue homogenates by c-ELISA. The serum IFN-α level was slight increased at 12 hpi when compared to uninfected control levels, thereafter gradually increased and reached to peak levels at 36 hpi. The levels were started to decrease rapidly after 36 hpi and became minimal at 60 hpi (Fig. 2). The serum IFN-β level was showed slight increase at 6 hpi when compared to uninfected control levels, thereafter gradually increased and reached to peak levels at 24 hpi. The peak levels were maintained up to 36 hpi and the levels were started to decrease rapidly, and became minimal at 60 hpi (Fig. 3). The IFN-α level was slight increased in spleen at 24 hpi when compared to uninfected control levels, thereafter gradually increased and reached to peak levels at 48 hpi. The levels were started to decrease rapidly, and became minimal at 72 hpi (Fig. 2). The IFN-β level in spleen was showed slight increase at 12 hpi when compared to uninfected control levels, thereafter gradually increased and reached to peak levels at 36 hpi. The levels were started to decrease rapidly and became minimal at 60 hpi (Fig. 3). The mRNA gene expression levels of type I IFNs were quantified in blood and spleen by qRT-PCR. In blood, IFN-α expression was started to increase at 12 hpi and were started to decrease rapidly after 36 hpi and became reached to peak expression at 36 hpi. The expression levels minimal at 120 hpi (Fig. 4). The IFN-α gene expression in blood was started to increase at 6 hpi and reached to peak expression levels at 36 hpi and the levels were started to decrease rapidly, and became minimal at 120 hpi (Fig. 5). The IFN-α expression in spleen was started to increase at 24 hpi, thereafter gradually increased and reached to peak expression levels at 48 hpi. The levels were started to decrease rapidly after 48 hpi and became minimal at 120 hpi (Fig. 4). The IFN-β expression in spleen was slightly increased at 12 hpi, thereafter gradually increased and reached to peak levels at 36 hpi. The levels were started to decrease rapidly, and became minimal at 120 hpi (Fig. 5). No recognizable gross and histopathological lesions were noticed in various organs (Fig. 6). Immunohistochemistry The BTV-1 antigen was demonstrated in axillary and inguinal lymph nodes, and spleen of infected groups collected at different time intervals. Only few macrophages and lymphocytes showed positive brown colour immunolabelling of BTV-1 antigen in lymph nodes (Fig. 7a) from 24 to 48 hpi and 36 to 60 hpi in spleen (Fig. 7b) in I/V route of inoculation. Uninfected control animals did not show any positive signals in all these target organs. Top DISCUSSION Ruminants are the natural host species for studying pathogenesis and testing of vaccines against BT experimentally1,2,20,21,22-23. However, main drawbacks of experimental infection studies in ruminants includes expensive, time consuming, stringent ethical issues, inclusion of less number of animals during experimentation, difficult in getting BTV sero-negative animals, complexity of the system, scarce knowledge of their immune system, and need to have an animal facility with Bio-Safety Level-31,12,13. |
To overcome these constrains, an efficient alternative animal model is use of adult mice because of the well known knowledge of its genetics and easy manageability12,13,24,25. |
However, adult mice were neither susceptible to BTV infection nor viremia was observed after I/V or S/C inoculation12,13. Previous studies demonstrated that BTV induced lesions varies with the age of the host3,4,14. Characteristic lesions of BT were noticed only in new born mice, when inoculated via the intracranial route26,27-28 and adult mice were not showing any lesions due to the influence of immunological maturity26,29,30. From many years ago, it was well established that BTV was an exceptionally potent interferon inducer in mice6. Studies suggested that possible limitation for the establishment of BTV infection in adult mice could be the innate immune responses namely, type I interferons produced at abnormally excessive levels against BTV by the host and causes brief and strong antiviral state6,10,12,13. An adult mouse model is necessary to conduct the studies of pathogenesis, acquired immune responses, and vaccines against BTV. |
Preliminary studies in our laboratory to establish clinical disease by BTV showed severe disease in neonatal mice, but not in adult mice27,28. The present study was conducted to solve this critical issue by studying the clinico-pathological, virological, and immunological responses in inbred adult Swiss albino mice (female, 6–8 weeks of age) in different experimental setups (Experiment 1–3). |
The present study assessed the influence of various factors like age of the host, dose of virus, route of inoculation, and type I IFNs in the clinical outcome of BTV infection in mice in different experimental framework. Adult female mice inoculated intravenously with 50 μl of 1×106 TCID50/ml of BTV-1 resulted in no development of clinical signs or disease or mortality. These findings were in agreement with the previous observations of12,14,31. Calvo-Pinilla et al.12 reported adult C57BL/6 mice (male, 8 weeks old) with intact IFN system infected intravenously with 106 PFUs of BTV-4 resulted in no development of symptoms or disease or mortality. Further, no viremia was detected in adult C57BL/6 mice with intact IFN system. Infection with BTV in 2-week- old mice resulted in very limited multiplication without any sequelae, and infection with BTV in 4-week-old mice did not cause clinical disease and no viral multiplication was detected14. The protective effects of baculovirus expressed BTV-10 minor and non-structural proteins were assessed by measuring virus titers in the ovaries of mice challenged with homologous recombinant vaccinia virus. Protection mediated by CTLs specific for the BTV could not be evaluated by challenging mice with BTV-10, because the virus didn't cause disease in adult mice31. |
The adult mice showed no differences in the survival rates, appearance of clinical signs and viremia between the S/C and I/V routes of inoculation of BTV-1. These findings were agreement with the previous findings in IFNAR(−/-) mice12,13,32. In contrast, one study compared the clinico-pathological aspects in sheep inoculated intradermally (I/D) and I/V with BTV-2322. This study suggested that I/D route of inoculation can be more potent in reproducing many aspects of natural infection, including clinical disease, viral and immune responses. |
In the experiment, I/V route was selected for BTV injection in adult mice. The route of inoculation is important because that may determine the outcome of infection. The I/V route of inoculation resembles the natural infection route by mosquito bite. An investigation using I/V route for establishment of BTV infection in interferon alpha/beta receptor deficient mice resulted in severe BT12. Another study used I/V route for assessing the potent interferon inducing effect of BTV in mice6. It was observed that lung lesions were relatively higher in the I/V route of inoculation when compared to I/D22. Intravenous route of infection has been followed by several earlier workers1,2,33 for experimental reproduction of BT in ruminants. |
The Swiss albino adult mice inoculated I/V with 50, 75, and 100 μl of 1×106 TCID50/ml of BTV-1 result in failed to development of clinical signs or disease or mortality up to 120 hpi. However, increasing the dose of the virus enhances the type I IFNs levels in serum and spleen tissue homogenate. This indicated that quantity of virus was not responsible for BTV-1 infection in adult mice, because quantity of virus increasing the type I IFNs production due to more viral replication. These findings were in agreement with the previous findings12, which reported that adult C57BL/6mice with intact IFN system did not show any clinical signs of disease, even when these animals were infected at the highest viral dose of BTV. However, in IFNAR(−/-) mice appearance of viremia was dependent on the viral dose, even small dose of virus was able to cause the disease, indicates role of type I IFNs in the clinical outcome of BT in adult mice. |
An interesting feature of BT is the extreme variability of the clinical outcome and susceptibility of the host to BTV varies significantly2. Species-like sheep, yak, llamas, and alpacas have been described as the most sensitive species to BT. Cattle and other wild ruminants have a certain degree of resistance to disease, although they are fully susceptible to infection. Cattle show longer periods of viremia, therefore, considered as reservoirs of infection36. Goats are also susceptible to BTV infection but do not appear to be highly susceptible; however, recent outbreaks of BTV-8 in Europe showed that goats are highly susceptible16,23. |
Our study attempted to develop adult mice model because BTV infection in newborn mice leads to severe cerebral lesions and pathology, which do not resemble the respiratory and immunosuppressive lesions observed in classical BT in the natural host. In the present study, type I IFNs such as IFN-α and IFN-β levels in serum and spleen tissue homogenate were increased early at 6 hpi, and reached to maximum levels at 36 hpi. BTV is a potent type I IFN inducer in mice and cattle6,8,35. Jameson et al.6 reported that BTV-8 was 5 to 10 times more potent IFN inducer when compared to other viral or non-viral agents, and inducing as much as 600,000 units/ml of plasma after 8 hpi. Ortego et al.13 studied the kinetics of IFN-α and IFN-β production in serum of IFNAR(−/-) mice infected subcutaneously with BTV-4. The IFN-α and IFN-β levels were started to increase in serum at 72 and 48 hpi, respectively and both IFN levels were reached maximum at 96 hpi. |
In this study, after type I IFNs peak, no virus was detected from blood and spleen. Increased type I IFN levels are the earliest innate immune response after BTV exposure resulted in brief and strong anti-viral state. Rapid induction of type I IFNs played crucial role in the inhibition of viral spread before development of specific adoptive immune response1,10,13. The IFN system compromisation is necessary for efficient replication of many viruses in mouse models like measles, polio, influenza and zika viruses10,13. In another study, antimouse IFNAR1 monoclonal antibody was administered intraperitoneally at a dose rate of 2.5 mg/mouse resulting in blocking of the type I IFN signal transduction effectively and establishes the BTV-1 infection and severe disease in adult mouse, which mimics the natural host infection. In previous studies, BTV was found pathogenic in IFNAR(−/-) mice mainly due to the lack of the IFN-I receptor, allowing the virus to circumvent the IFN-I response in the host and reproduces many aspects of its natural host infection12,13,24. |
Thus, on the basis of the present study, it was concluded that clinical outcome of BTV infection in adult mice is neither dependent on the route of inoculation nor on the dose of virus. However, clinical outcome of BTV infection depends on age of the host and type I IFN levels. Further, establishment of BTV infection in adult mice requires type I IFN system compromization to circumvent the type I IFN response in the host, resulting in reproduction of many aspects of its natural host infection. |
Top ACKNOWLEDGMENTS We acknowledge the financial support of research grant from AINP-BT (Grant No. 3(8)/98 ASR-IV, dated 23.3.2001), CADRAD, ICAR-IVRI, Uttar Pradesh, India. We thank Director, Joint Directors and Head, Division of Pathology, ICAR-IVRI for providing all the facilities to carry out this research work. |
Top Figures | Fig. 1.: RT-PCR detection of amplified product (243 bp) of BTV nucleic acid in spleen of 75 and 100 μL of 1×106 TCID50/ml of BTV-1. Lane M: 100 bp DNA ladder; L10-Positive control; L9-Negative control; L4-L8-Samples at 24, 36, 48, 60, and 72 hpi showed positive; L1-L3- Samples at 84, 96, and 120 hpi showed negative.
|  | |
| | Fig. 2.: Concentration of IFN-α (Fig. 2) and IFN-β (Fig. 3) in serum and spleen tissue homogenates estimated by c-ELISA at various time intervals. Mean with asterisks (**P<0.01; ***P<0.001) at a given hpi indicates statistically significant when compared uninfected control group.
|  | |
| | Fig. 3.: Concentration of IFN-α (Fig. 2) and IFN-β (Fig. 3) in serum and spleen tissue homogenates estimated by c-ELISA at various time intervals. Mean with asterisks (**P<0.01; ***P<0.001) at a given hpi indicates statistically significant when compared uninfected control group.
|  | |
| | Fig. 4.: Fold change of IFN-α (Fig. 4) and IFN-β (Fig. 5) gene expression in blood and spleen quantified by qRT-PCR at various time intervals. Mean with asterisks (*P<0.05; **P<0.01; ***P<0.001) at a given hpi indicates statistically significant when compared uninfected control group.
|  | |
| | Fig. 5.: Fold change of IFN-α (Fig. 4) and IFN-β (Fig. 5) gene expression in blood and spleen quantified by qRT-PCR at various time intervals. Mean with asterisks (*P<0.05; **P<0.01; ***P<0.001) at a given hpi indicates statistically significant when compared uninfected control group.
|  | |
| | Fig. 6.: Histopathologcal images of uninfected control-no leasion (a,c,e) and BTV-1 infected (b,d,f) groups at 120 hpi. 6a. Uninfected control lymph node showed normal cortex and medulla. H&E ×200. 6b. BTV-1 infected lymph node showed mild lymphoid depletion in cortex. H&E ×200. 6c. Uninfected control spleen showed normal white pulp area. H&E ×200. 6d. BTV-1 infected spleen showed no histopathological chages. H&E ×200. 6e. Uninfected control lung showed normal alveoli are lined by flattened squamous epithelium. H&E ×200. 6f. BTV-1 infected lung showed congestion in interalveolar capillaries and mild thickening of interalveolar septa. H&E ×200
|  | |
| | Fig. 7.: Few macrophages and lymphocytes in lymph node showed positive signals of BTV-1 antigen (arrow). IP-DAB-MH x200.
|  | |
| | Fig. 7b.: Few macrophages and lymphocytes in spleen showed localization of BTV-1 antigen (arrow). IP-DAB-MH x200.
|  | |
|
Tables | Table 1.: Primers used in this study for amplification of BTV genome
| | Gene | Primer Sequence | Primer Length | Product Length (bp) | Annealing Temperature (°C) | | BTV-VP7 | FP-5'-GAGATCACACATGGCATGG-3' | 19 | 243 | 56 | | RP-5'-CGTGCAAAGTGGACTACAC-3' | 19 | | | | BTV-1/Seg-2 | FP-5'-GGACATCACTTACGAGCAAGG-3' | 21 | 628 | 64 | | RP-5'-CAGTACTCTGAATCACGTGC-3' | 20 | | |
| | | Table 2.: Details of cytokine primers used in this study
| | Gene | Primer Sequence (5'-3') | Annealing Temperature (°C) | Product Length (bp) | References | | GAPDH | F: TGCACCACCAACTGCTTAG R: GGATGCAGGGATGATGTTC | 56 | 120 | McCarthy et al.17 | | IFN-α | F: AGGACAGGAAGGATTTTGGA R: GCTGCTGATGGAGGTCATT | 62 | 200 | McKimmie et al1 | | IFN-β | F: CTGGAGCAGCTGAATGGAAAG R: CTTGAAGTCCGCCCTGTAGGT | 62 | 200 | Samuel and Diamond19 |
| |
|